Alimu Kadeer1, Munila Anwar1, Niu Chun-yan2, Luo Jin-yan2
1Department of Composite Medicine, the First Affiliated Hospital of Xinjiang Medical University, Urumqi 830054, Xinjiang Uygur Autonomous Region, China; 2Department of Digestion, Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an 710000, Shaanxi Province, China
Alimu Kadeer★, Master, Attending physician, Lecturer, Department of Composite Medicine, the First Affiliated Hospital of Xinjiang Medical University, Urumqi 830054, Xinjiang Uygur Autonomous Region, China
alimjan7510@sina. com
Received:2010-03-31
Accepted:2010-06-11
(20100331006/WJ)
Alimu Kadeer, Munila Anwar, Niu CY, Luo JY. Genetic polymorphism of cytochrome P450 2C19 in Xinjiang Uigur population versus Han population. Zhongguo Zuzhi Gongcheng Yanjiu yu Linchuang Kangfu. 2010;14(31): 5887-5890.
[http://www.crter.cn http://en.zglckf.com]
Abstract
BACKGROUND: Previous studies demonstrated that, metabolic phenotype of cytochrome P450 2C19 has genetic polymorphism, which presents with extensive or poor metabolisms and has great differences in races and individuals.
OBJECTIVE: To study the genotype distribution of cytochrome P450 2C19 in Xinjiang Uigur population.
METHODS: In total 144 unrelated Uigur and 156 unrelated Han subjects were genotyped for cytochrome P450 2C19 by polymerase chain reaction-restriction fragment length polymorphism. The differences of gene phenotype and gene frequency were compared between Uigur and Han populations.
RESULTS AND CONCLUSION: The frequency of extensive metabolism wt/wt, wt/m and wt/m1+wt/m2 of Uigur was notably higher than that of Han population (P < 0.05), but the frequency of poor metabolism m1/m1 was obviously lower than that of Han population (P < 0.05). There were significant differences between Uigur and Han populations in allele frequency wt, m1 and m2 (P < 0.05), especially m1, which was 58-fold of m2 (P < 0.01). The results revealed that, distribution frequency m1/m1 of poor metabolism of Uigur is obviously lower than that in Han population, and m1 frequency is higher than that of Han population, accordingly, m1 is the main gene mutation of cytochrome P450 2C19 in Uigur population.
INTRODUCTION
Uigurs mainly inhabit Xinjiang Uygur Autonomous Region, the gene distribution of which has distinction compared with other population in China due to varied history, culture and living habits. Lan et al[1-2] found that the Rh type polymorphism features of Uigur was the same as both Oriental populations and Caucasians. Previous studies demonstrated that cytochrome P450 2C19 (CYP2C19) is the major (S)-mephenytoin 4’-hydroxylase, and its metabolic phenotype exhibits a genetic polymorphism[3], which presents as extensive or poor metabolism. The gene phenotype and gene frequency of poor metabolism trait being inherited in an autosomal recessive fashion and there are notably differences between different races and individuals[3-4].
The gene phenotype and gene frequency should be considered in predicting drug metabolism and adverse effect, selecting drugs doses, determining compatibility of drugs, as well as judging therapeutic effects in the clinic, such approaches promise the advent of “personalized medicine”, in which drugs and drug combinations are optimized for each individual’s unique genetic makeup[5]. Accordingly, it has great important to discuss the CYP2C19 polymorphism. Here, the genotype distribution of CYP2C19 in Xinjiang Uigur was explored, and the results were compared with Han population. This study can provide help for determining the appropriateness and dosage of most commonly prescribed drugs, which can further optimize the therapeutic effect[6].
SUBJECTS AND METHODS
Design
A genetic polymorphism analysis.
Time and setting
The experiment was performed at the Department of Composite Medicine, the First Affiliated Hospital of Xinjiang Medical University from February 2008 to October 2009.
Subjects
In total 144 unrelated Uigur Chinese population were selected, including 75 males and 69 females, aged 18-34 years, mean aged (25±5) years. Additional 156 unrelated Han subjects were collected, including 78 males and 78 females, aged 19-29 years, mean aged (23±8) years.
Inclusive criteria: ①All subjects had no history of server diseases. ②No abnormality was found in physical and routine examinations.
According to the Administrative Regulations on Medical Institution published by State Council of the People’s Republic of China[7], the informed contents were obtained from all subjects prior to the experiment.
The reagents and instruments used are listed as follows:
Reagent and instrument Source
Taq DNA polymerase, DNA molecular weight standard substance pUC19DNA/ MspI(HpaII) Marker MBI, USA
Genomic DNA Extraction Kit Sangon Biotech (Shanghai) Co., Ltd., China
DNA Gel Extraction Kit Hangzhou Vitagene Biological Company, China
Bam HI, Sma I restriction endonuclease Takara Biotechnology (Dalian) Co., Ltd., China
Type PTC-150 PCR Instrument MJ Research, Inc., USA
M-250 electrophoresis apparatus Jiemai Kemao Co., Ltd., China
Methods
Design and synthesis of primers
The exon 4 and exon 5 specific primers was designed based on base sequences of CYP2C19 allele intron 4, 5 and intron 5, 6, respectively, and synthesized by Sangon Biotech (Shanghai) Co., Ltd.
Primers are listed as follows:
Gene Sequence (5’-3’)
Exon 4
Upstream
Downstream CACCCTGTGATCCCACTTTC
CTAATGGGCTTAGAAGCCTG
Exon 5 Upstream CAACCAGAGCTTGGCATATTG
Downstream CACAAATACGCAAGCAGTCAC
Genomic DNA extraction
A total of 5 mL blood were drawn from peripheral veins of subjects and placed in pre-EDTA anticoagulant test tubes. 1 mL aseptic double distilled water was added into blood samples (500 μL), centrifugated for 2 minutes with speed of 5 000 r/min at room temperature, removed supernatant, and TE solution (200 μL) was added to suspend leucocytes. After that, 400 μL cell lysis buffers was added, mixed, followed by mixture with 3 μL protein kinase K, and placed at 55 ℃ water bath for more than 1 hour. Subsequently, 600 μL chloroform was mixed evenly with the composites, followed by 2-minute centrifugation with speed of 10 000 r/min. 500 μL supernatant was transferred to a 1.5 mL centrifuge tube and mixed with 500 μL precipitator, placed for 2 minutes at room temperature, followed by a second 2-minute centrifugation with speed of 10 000 r/min. The supernatant was discarded, 100 μL sodium chloride solutions (1.2 mol/L) was added immediately, shocked, until the DNA sample was completely soluble. 3 μL RNase A was added and the tube was placed at 37 ℃ for 10 minutes to remove RNA. 300 μL pre-cooling absolute ethanol was added, and the tube was placed in -20 ℃ for 10 minutes, centrifugation, 10 000 r/min for 3-4 minutes, followed by washing with 70% ethanol, drying at room temperature for 10 minutes, dissolving DNA, and the sample was stored at -20 ℃. [paging]
Analysis of polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP)
PCR amplification: 1% agarose gel electrophoresis was performed on PCR products, and the target strip was cut down under a viltalight lamp. DNA was retrieved using DNA gel extraction kit. RFLP analysis: The target fragment was digested by restriction enzyme, followed by 37 ℃ water bath, overnight, and identified by 1.5% agarose gel electrophoresis. The strips were observed under a 300-nm viltalight lamp.
Main outcome measures
Expression of CYP2C19 gene exons 4 and 5 was observed. The gene phenotype and gene frequency of CYP2C19 between Uigur and Han populations were compared.
Statistical analysis
All data were analyzed using SPLM statistical software. The gene phenotype and gene frequency were calculated using gene counting method. Chi-square test was employed to compare groups. A value of P < 0.05 was considered statistically significant.
RESULTS
Quantitative analysis of experimental subjects
A total of 144 Uigur and 156 Han population were included in the final analysis. No subject dropped in the experiment.
Expression of CYP2C19 gene exons 4 and 5
The length of exon 5 was 283.5 bp, and the mutagenesis was at Sma I restriction site, which presented with 3 banding patterns following Sma I restriction, namely, in wild type, there were two fragments at 170 and 114 bp; in heterozygote type, there were three fragments at 284.5, 152 and 112 bp; there was only on strip at 285 bp in the homozygous mutant because of unable to cut down. The length of exon 4 was 377 bp, and mutagenesis was at Bam HI restriction site, which presented with two fragments at 223 and 150 bp in wild type and three fragments at 377, 222 and 149 bp in heterozygote type after Bam HI restriction (Figure 1).
Comparison of gene phenotype and gene frequency of CYP2C19 between Uigur and Han populations (Table 1)
[paging]
In Uigur, the frequency of extensive metabolizers wt/wt, wt/m, and wt/m1+wt/m2 was 96.05%, which was notably higher than that of Han population (P < 0.05). The frequency of poor metabolizers1 m1/m1 was 6.17%, which was obviously lower than Han population (14.42%) (P < 0.05). There were significant differences between Uigur and Han populations in allele frequency wt, m1 and m2 (P < 0.05), especially m1, which was 58-fold of m2 (P < 0.01).
DISCUSSION
Related knowledge and background
Previous studies have demonstrated that the metabolic phenotype of (S)-mephenytoin 4’-hydroxylase (S-MP) is genetic polymorphism and involved in metabolisms of many drugs, such as mephenytoin, diazepam, phenobarbital, propranolol, omeprazole, proguanil, and pantoprazole[3]. Wrighton et al[8] isolated a new enzyme from human livers and named CYP2C19 in 1993. The hydroxylation metabolism of S-MP is mainly mediated by CYP2C19 protein.
Studies showed that, most of individual can perform hydroxylation metabolism of S-MP quickly, called extensive metabolizer, and a person who metabolizes a probe drug–the rate of which is related to the metabolizing cytochrome P-450 enzyme–slower than others was called poor metabolizer. It is eliminated primarily by oxidative metabolism through the CYP2C19 enzymatic pathway, namely, CYP2C19 genetic polymorphism. de Morais et al[4] found that two allelic mutable site of S-MP in Japanese poor metabolizers in 1994, which named CYP2C19m1 (exon 5 mutation) and CYP2C19m2 (exon 4 mutation). CYP2C19m1 and CYP2C19m2 are two independent alleles, the end product of which lack of catalytic activity, thus, it loss ability of hydroxylation metabolism to MP and other matters.
Kubota et al [9] demonstrated that, the frequency of CYP2C19 poor metabolizers of Oriental population (13%-23%) was obviously higher than that of Caucasians (3%-5%), in Japanese, the frequency was 18.86%, and which of the Black people lies between Caucasians and Oriental population. Accordingly, it is important to study the relationship between CYP2C19 genetic polymorphism and pharmacokinetics of Oriental population.
Results analysis
Most of the population of Xinjiang Uygur Autonomous Region is Uigur population, which different from Han population in history, culture and living habits. The results demonstrated that, the frequency of poor metabolizers of Uigur was lower than that of Han population, but the extensive metabolizers were higher than Han population. Allele frequency wt of Uigur was obviously lower than Han population, the m1 was 58-fold of m2, which was higher than Han population, but the m2 frequency was lower than Han population. It can be seen that the distribution features of CYP2C19 and m1 allele frequency in Uigur were similar to Caucasians. However, wt allele frequency was higher than Caucasians. The main gene mutation of CYP2C19 was m1, which was the same as Han population, but there was great difference in genetic polymorphism. The experiments also showed that, the phenotypic frequency of heterozygote (96.05%) was notably higher than that of homozygote (6.17%). Area features and certain acquired predisposition, such as eating habit, smoking or taking other drugs may be involved in this change besides varied history, culture and living habits[10-11].
Bias or deficiency of this study
The case number was small in this study, thus, the results should be verified by multi-center research with larger samples. This is also the focus of further study.
Clinical application significance
Pharamcogenomics is a hot focus at present. This paper explores the polymorphism distribution of CYP2C19 in Uigur population and obtains a different outcome compared with Han population. Ethnic difference is noted in CYP2C19 gene. Thus, it provides reference for analyzing distribution features of CYP2C19 gene variation.
Summary
The results revealed that, distribution frequency m1/m1 of poor metabolizers in Uigur population is obviously lower than that in Han population, and m1 frequency is higher than that of Han population, accordingly, m1 is the main gene variation of cytochrome P450 2C19 in Uigur population.[paging]
REFERENCES
[1] Lan JC, Zhou HY, Bai XH, et al. Investigation of the characteristics of Rh blood group of uygur nationality in xinjiang. Zhongguo Shiyan Xueyexue Zazhi. 2007;15(4):223-224.
[2] Lan JC, Wang CR, Wei YM, et al. Observation on gene polymorphism of Rh blood group in Chinese han nationality. Zhongguo Shiyan Xueyexue Zazhi. 2003;11(6):642-645.
[3] Goldstein JA, Faletto MB, Romkes M, et al. Evidence that CYP2C19 is the major (S)-mephenytoin 4'-hydroxylase in humans. Biochemistry. 1994;33(7):1743-1752.
[4] de Morais SMF, Wilkinson GR, Blaisdell J, et al. The major genetic defect responsible for the polymorphism of S- mephenytoin in humans. J Biol Chem. 1994;269:15419-15422.
[5] Chang JG, Yang TY, Liu TC, et al. Molecular analysis of secretor type α(1,2)-fucosyltransferase gene mutations in the Chinese and Thai populations. Transfution. 1999;39(9):1013-1017.
[6] Kelly RJ, Rouquier S, Giorgi D, et al. Sequence and expression of candidate for the human secretor blood group alph(1,2) fucosyl-transferase gene (FUT2). Homozygosity for an enzyme-inactivating non-sense mutation commonly correlates with the non-secretor phenotype. J Biol Chem. 1995;270(9):4640-4649.
[7] State Council of the People's Republic of China. Administrative Regulations on Medical Institution. 1994-09-01.
[8] Wrighton SA, Stevens JC, Becker GW, et al. Isolation and characterization of human liver cytochrome P4502C19: correlation between 2C19 and S-mephenytoin 4′- hydroxylation. Arch of Biochem and Biophys. 1993;306(1):240.
[9] Kubota T, Chiba K, Ishizaki T. Genotyping of S-mephenytoin 4'-hydroxylation in an extended Japanese population. Clin Pharmacol Ther. 1996;60(2):661-666.
[10] Ramsj? M, Aklillu E, Bohman L, et al. CYP2C19 activity comparison between Swedes and Koreans: effect of genotype, sex, oral contraceptive use, and smoking. Eur J Clin Pharmacol. 2010.
[11] Aleil B, Léon C, Cazenave JP, et al. CYP2C19*2 polymorphism is not the sole determinant of the response to clopidogrel: implications for its monitoring. J Thromb Haemost. 2009;7(10):1747-1749.